www.kryfokamari.blogspot.com

Τετάρτη, 30 Μαΐου 2012

Πανελλαδικές εξετάσεις: Βιολογία Θετικής κατεύθυνσης


ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ
ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ
ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ
ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ
(ΟΜΑΔΑ Β΄)
ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012
ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ
ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ
ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5)

ΘΕΜΑ Α
Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις
παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το
γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία
συμπληρώνει σωστά την ημιτελή πρόταση.
Α1. Η διπλή έλικα του DNA ξετυλίγεται κατά τη μεταγραφή
από το ένζυμο
α. RNA πολυμεράση
β. DNA πολυμεράση
γ. DNA ελικάση
δ. DNA δεσμάση.
Μονάδες 5

Α2. Οι ιστόνες είναι
α. DNA
β. RNA
γ. πρωτεΐνες
δ. υδατάνθρακες.
Μονάδες 5
Α3. Ασθένεια που μπορεί να διαγνωστεί με καρυότυπο είναι
α. η φαινυλκετονουρία
β. η δρεπανοκυτταρική αναιμία
γ. η β-θαλασσαιμία
δ. το σύνδρομο Cri du chat.
Μονάδες 5
Α4. Σύνδεση κωδικονίου με αντικωδικόνιο πραγματοποιείται
κατά την
α. αντιγραφή
β. μετάφραση
γ. μεταγραφή
δ. αντίστροφη μεταγραφή.
Μονάδες 5
ΑΡΧΗ 2ΗΣ ΣΕΛΙΔΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ
ΤΕΛΟΣ 2ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ
Α5. Ο αλφισμός οφείλεται σε γονίδιο
α. αυτοσωμικό επικρατές
β. φυλοσύνδετο επικρατές
γ. αυτοσωμικό υπολειπόμενο
δ. φυλοσύνδετο υπολειπόμενο.
Μονάδες 5
ΘΕΜΑ Β
Β1. Πώς χρησιμοποιούνται τα μονοκλωνικά αντισώματα για
την επιλογή οργάνων συμβατών στις μεταμοσχεύσεις;
Μονάδες 6
Β2. Να περιγράψετε τη διαδικασία κλωνοποίησης με την
οποία δημιουργήθηκε το πρόβατο Dolly.
Μονάδες 7
Β3. Πού οφείλεται η αυξημένη συχνότητα των ετερόζυγων ατόμων
με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία σε χώρες όπου
εμφανιζόταν ελονοσία;
Μονάδες 6
Β4. Να αναφέρετε ποια θρεπτικά συστατικά είναι απαραίτητα
για να αναπτυχθεί ένας μικροοργανισμός σε μια
καλλιέργεια.
Μονάδες 6
ΘΕΜΑ Γ
Γ1. Μια αρσενική μύγα Drosophila με λευκά μάτια
διασταυρώθηκε με μια θηλυκή με κόκκινα μάτια. Από
τη διασταύρωση αυτή πήραμε 280 απογόνους στην F1
γενιά που είχαν όλοι κόκκινα μάτια. Διασταυρώνοντας
δύο άτομα από την F1 γενιά προκύπτουν 319 απόγονοι
στην F2 γενιά. Μια ανάλυση των απογόνων της F2
γενιάς έδειξε ότι υπάρχουν:
159 θηλυκά με κόκκινα μάτια, 82 αρσενικά με κόκκινα
μάτια και 78 αρσενικά με λευκά μάτια.
Με βάση τα δεδομένα να εξηγήσετε τον τρόπο με τον
οποίο κληρονομείται το παραπάνω γνώρισμα.
Για τα άτομα που διασταυρώθηκαν δίνεται ότι τα
θηλυκά έχουν ένα ζευγάρι X χρωμοσωμάτων (ΧΧ) και
ΑΡΧΗ 3ΗΣ ΣΕΛΙΔΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ
ΤΕΛΟΣ 3ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ
τα αρσενικά έχουν ένα Χ και ένα Ψ χρωμόσωμα (ΧΨ).
Να μη ληφθεί υπόψη η περίπτωση μετάλλαξης.
Μονάδες 5
Δίνεται το παρακάτω γενεαλογικό δέντρο, όπου
απεικονίζεται ο τρόπος με τον οποίο κληρονομείται μια
μονογονιδιακή ασθένεια.
Τα άτομα ΙΙ2, ΙΙ3, ΙΙΙ3, και ΙV3 πάσχουν από την ασθένεια
αυτή. Για όλα τα παρακάτω ερωτήματα να μη ληφθεί υπόψη
η περίπτωση μετάλλαξης.
3
ΙV
1 2
Ι
1 2 3 4
ΙΙ
1 2 3 4
ΙΙΙ
1 2 3 4
Γ2. Με βάση τα δεδομένα του γενεαλογικού δένδρου να
εξηγήσετε τον τρόπο με τον οποίο κληρονομείται η
ασθένεια.
Μονάδες 6
Γ3. Να προσδιορίσετε την πιθανότητα το ζευγάρι ΙΙΙ1 , III2
να αποκτήσει αγόρι που θα πάσχει (μονάδα 1).
Να αιτιολογήσετε την απάντησή σας (μονάδες 7).
Μονάδες 8
Γ4. Αν τα άτομα Ι1 και Ι4 πάσχουν από μια ασθένεια που
οφείλεται σε γονίδιο μιτοχονδριακού DNA, να
ΑΡΧΗ 4ΗΣ ΣΕΛΙΔΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ
ΤΕΛΟΣ 4ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ
αναφέρετε ποια άτομα του γενεαλογικού δένδρου θα
κληρονομήσουν το γονίδιο αυτό (μονάδες 2). Να
αιτιολογήσετε την απάντησή σας (μονάδες 4).
Μονάδες 6
ΘΕΜΑ Δ
Δίνεται το παρακάτω τμήμα βακτηριακού DNA, το οποίο
κωδικοποιεί ένα ολιγοπεπτίδιο.
Αλυσίδα 1: GTTGAATTCTTAGCTTAAGTCGGGCATGAATTCTC
Αλυσίδα 2: CAACTTAAGAATCGAATTCAGCCCGTACTTAAGAG
Δ1. Να προσδιορίσετε την κωδική και τη μη κωδική
αλυσίδα του παραπάνω τμήματος DNA, επισημαίνοντας
τα 5΄ και 3΄ άκρα των αλυσίδων του (μονάδες 1). Να
αιτιολογήσετε την απάντησή σας (μονάδες 5).
Μονάδες 6
Δ2. Το παραπάνω τμήμα DNA αντιγράφεται, και κατά τη
διαδικασία της αντιγραφής δημιουργούνται τα
παρακάτω πρωταρχικά τμήματα:
i) 5’-GAGAAUUC-3’
ii) 5’-UUAAGCUA-3’
iii) 5’-GUUGAAUU-3’
Να προσδιορίσετε ποια αλυσίδα αντιγράφεται, με
συνεχή και ποια με ασυνεχή τρόπο (μονάδες 1). Να
αιτιολογήσετε την απάντησή σας (μονάδες 5).
Μονάδες 6
Δ3. To παραπάνω τμήμα DNA κόβεται με το ένζυμο EcoRI,
προκειμένου να ενσωματωθεί σε ένα από τα δύο
πλασμίδια Α και Β που δίνονται παρακάτω.
GAATTC
CTTAAG
5’ 3’
CTTAAG
GAATTC
5’ 3’
Α Β
ΑΡΧΗ 5ΗΣ ΣΕΛΙΔΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ
ΤΕΛΟΣ 5ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ
Ποιο από τα δύο πλασμίδια θα επιλέξετε για τη
δημιουργία ανασυνδυασμένου πλασμιδίου (μονάδα 1);
Να αιτιολογήσετε την απάντησή σας (μονάδες 4). Πόσοι
φωσφοδιεστερικοί δεσμοί θα διασπαστούν στο
πλασμίδιο που επιλέξατε και πόσοι θα δημιουργηθούν
κατά το σχηματισμό του ανασυνδυασμένου πλασμιδίου
(μονάδες 2);
Μονάδες 7
Δ4. Από τη μύγα Drosophila απομονώθηκαν τρία διαφορετικά
φυσιολογικά κύτταρα στα οποία προσδιορίστηκε το μέγεθος
του γονιδιώματος σε ζεύγη βάσεων. Στο πρώτο κύτταρο το
μέγεθος του γονιδιώματος υπολογίστηκε σε 3,2·108 ζεύγη
βάσεων, στο δεύτερο κύτταρο σε 1,6·108 ζεύγη βάσεων και στο
τρίτο κύτταρο σε 6,4·108 ζεύγη βάσεων. Να δικαιολογήσετε
γιατί υπάρχουν οι διαφορές αυτές στο μέγεθος του
γονιδιώματος των τριών κυττάρων.
Μονάδες 6
ΟΔΗΓΙΕΣ (για τους εξεταζομένους)
1. Στο τετράδιο να γράψετε μόνο τα προκαταρκτικά (ημερομηνία,
εξεταζόμενο μάθημα). Να μην αντιγράψετε τα θέματα στο
τετράδιο.
2. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των
φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Δεν επιτρέπεται
να γράψετε καμιά άλλη σημείωση. Κατά την αποχώρησή σας να
παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα.
3. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα.
4. Να γράψετε τις απαντήσεις σας μόνο με μπλε ή μόνο με μαύρο
στυλό. Μπορείτε να χρησιμοποιήσετε μολύβι μόνο για σχέδια,
διαγράμματα και πίνακες.
5. Να μη χρησιμοποιήσετε χαρτί μιλιμετρέ.
6. Κάθε απάντηση τεκμηριωμένη είναι αποδεκτή.
7. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των
φωτοαντιγράφων.
8. Χρόνος δυνατής αποχώρησης: 10.30 π.μ.
ΚΑΛΗ ΕΠΙΤΥΧΙΑ
ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ

Δεν υπάρχουν σχόλια: